Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ZNF383 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 163087 chr19 + 37712365 - 37722365 0 Transcription Factor Binding Sites   Download all TFBS in the ZNF383 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ZNF232_C2H2_full_monomeric_19_1 SELEX + 37719097 37719115 2.0E-06 GCGTTACCGGTAGACCAAG 19 FOXJ3_forkhead_DBD_dimeric_14_1 SELEX - 37719170 37719183 9.0E-06 ATAAAAAGTGACCA 14 SCRT1_C2H2_DBD_monomeric_15_1 SELEX + 37719070 37719084 6.0E-06 AAGTAACAGGTGCCT 15 V_CTCF_02_M01259 TRANSFAC - 37719116 37719135 2.0E-06 ACTGGGCCACTAGAGGGCTC 20 V_CTCF_01_M01200 TRANSFAC - 37719114 37719133 2.0E-06 TGGGCCACTAGAGGGCTCCT 20 V_MYF6_03_M02781 TRANSFAC + 37719070 37719085 4.0E-06 AAGTAACAGGTGCCTT 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.