Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OTUD7A Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 161725 chr15 + 31942542 - 31952542 0 Transcription Factor Binding Sites   Download all TFBS in the OTUD7A promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 31942712 31942730 0.0E+00 TGGCCACTAGGTGGCGCTT 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 31942713 31942729 0.0E+00 AGCGCCACCTAGTGGCC 17 V_CTCF_02_M01259 TRANSFAC + 31942709 31942728 0.0E+00 GGCTGGCCACTAGGTGGCGC 20 V_CTCF_01_M01200 TRANSFAC + 31942711 31942730 0.0E+00 CTGGCCACTAGGTGGCGCTT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.