Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

C9orf84 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 158401 chromosome 9 open reading frame 84 chr9 - 114545279 - 114550779 114545779 Transcription Factor Binding Sites   Download all TFBS in the C9orf84 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints POU6F2_POU_DBD_dimeric_16_1 SELEX + 114546470 114546485 6.0E-06 TTAATGATCCATTTAG 16 POU6F2_POU_DBD_dimeric_16_1 SELEX - 114546470 114546485 8.0E-06 CTAAATGGATCATTAA 16 LHX9_homeodomain_DBD_dimeric_13_1 SELEX - 114546471 114546483 7.0E-06 AAATGGATCATTA 13 EN1_homeodomain_full_dimeric_14_1 SELEX - 114546471 114546484 4.0E-06 TAAATGGATCATTA 14 V_DMRT3_01_M01148 TRANSFAC - 114546449 114546463 1.0E-06 AATTGGTTACATTAA 15 V_NKX25_Q6_M02108 TRANSFAC - 114546386 114546396 0.0E+00 CTCACTTGAAG 11 V_TATA_C_M00216 TRANSFAC - 114546364 114546373 4.0E-06 ACTATAAAAT 10 V_GLI3_01_M01596 TRANSFAC - 114546409 114546419 2.0E-06 CTGGGTGGCCT 11 V_IPF1_05_M01255 TRANSFAC - 114546467 114546478 5.0E-06 GATCATTAAGAA 12 V_DMRT2_01_M01147 TRANSFAC - 114546343 114546358 6.0E-06 GGGAATGCAACATTCT 16 V_DMRT2_01_M01147 TRANSFAC - 114546449 114546464 1.0E-05 CAATTGGTTACATTAA 16 V_DMRT2_01_M01147 TRANSFAC + 114546469 114546484 2.0E-06 CTTAATGATCCATTTA 16 V_PPARG_02_M00515 TRANSFAC - 114546399 114546421 7.0E-06 TTCTGGGTGGCCTTGGCCTCCTT 23 V_PIT1_Q6_M00802 TRANSFAC + 114546465 114546482 3.0E-06 CCTTCTTAATGATCCATT 18 V_BARX1_01_M01340 TRANSFAC - 114546453 114546468 4.0E-06 AAGGCAATTGGTTACA 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.