Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SLC7A13 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 157724 solute carrier family 7 (anionic amino acid transporter), member 13 chr8 - 87242104 - 87247604 87242604 Transcription Factor Binding Sites   Download all TFBS in the SLC7A13 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Pax4_MA0068.1 JASPAR + 87245261 87245290 1.0E-05 CAATAAATTCCCCACCTAACAATCTACTTT 30 V_CEBP_C_M00201 TRANSFAC + 87245299 87245316 5.0E-06 ATAGTGAGGCAATCCACT 18

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.