Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SLC25A52 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 147407 solute carrier family 25, member 52 chr18 - 29340343 - 29345843 29340843 Transcription Factor Binding Sites   Download all TFBS in the SLC25A52 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NRF1_NRF_full_dimeric_12_1 SELEX + 29340859 29340870 5.0E-06 TGCGCAGGCGCA 12 NRF1_NRF_full_dimeric_12_1 SELEX - 29340859 29340870 5.0E-06 TGCGCCTGCGCA 12 V_SP1_02_M01303 TRANSFAC + 29340887 29340897 8.0E-06 GGGGCGGGGGC 11 V_WT1_Q6_01_M02036 TRANSFAC - 29340889 29340898 4.0E-06 CGCCCCCGCC 10 V_KROX_Q6_M00982 TRANSFAC - 29340887 29340900 1.0E-06 TGCGCCCCCGCCCC 14 V_SP4_Q5_M01273 TRANSFAC - 29340886 29340896 7.0E-06 CCCCCGCCCCG 11 V_ZFP206_01_M01742 TRANSFAC - 29340860 29340870 8.0E-06 TGCGCCTGCGC 11 V_P53_04_M01652 TRANSFAC - 29340844 29340863 9.0E-06 GCGCAGGTCCCGGCTTGCTC 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.