Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CRYGD Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 1421 crystallin, gamma D chr2 - 208988813 - 208994313 208989313 Transcription Factor Binding Sites   Download all TFBS in the CRYGD promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_FOXP1_01_M00987 TRANSFAC + 208989341 208989360 2.0E-06 ATTTTCGTGTTCTCTTTTTT 20 V_TCFAP2E_04_M02926 TRANSFAC - 208989354 208989367 3.0E-06 AAAGAGAAAAAAAG 14 V_EVI1_01_M00078 TRANSFAC - 208989350 208989365 8.0E-06 AGAGAAAAAAAGAGAA 16 V_STAF_02_M00264 TRANSFAC - 208989079 208989099 9.0E-06 TTGTCCCGCCTTGCCTTGCAG 21 V_KAISO_01_M01119 TRANSFAC - 208989276 208989285 7.0E-06 CTCCTGCTAT 10 V_PLAG1_01_M01778 TRANSFAC + 208989316 208989331 9.0E-06 GGGGCCCCCGGAGGGG 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.