Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ACTRT2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 140625 actin-related protein T2 chr1 + 2933045 - 2938545 2938045 Transcription Factor Binding Sites   Download all TFBS in the ACTRT2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints TBX1_TBX_DBD_dimeric_20_1 SELEX - 2937917 2937936 6.0E-06 AGGTGAGAGAGAGAGAGAGA 20 V_AIRE_02_M01000 TRANSFAC + 2940759 2940783 0.0E+00 GGTTTCTTAGTGGTCACCCTGGGTA 25 V_ZFP281_01_M01597 TRANSFAC + 2937944 2937954 5.0E-06 TGGGGGATGGG 11 V_ZFP281_01_M01597 TRANSFAC - 2937965 2937975 1.0E-06 TGGGGGTGGGG 11 V_ZFP281_04_M02831 TRANSFAC - 2937942 2937956 1.0E-05 CCCCCATCCCCCACA 15 V_TAACC_B_M00331 TRANSFAC - 2940764 2940786 8.0E-06 TAATACCCAGGGTGACCACTAAG 23

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.