Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

MAGEB16 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 139604 melanoma antigen family B, 16 chrX + 35811458 - 35816958 35816458 Transcription Factor Binding Sites   Download all TFBS in the MAGEB16 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints EBF1_EBF_full_dimeric_14_1 SELEX - 35816649 35816662 9.0E-06 ATTCCCGAGGGAGA 14 V_DELTAEF1_01_M00073 TRANSFAC - 35816667 35816677 2.0E-06 CTTCACCTTAA 11 V_PAX4_04_M00380 TRANSFAC - 35818791 35818820 9.0E-06 GGAAATAAGTAGATATCTCATCCTGACAGC 30

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.