Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SGCZ Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 137868 sarcoglycan, zeta chr8 - 15095292 - 15100792 15095792 Transcription Factor Binding Sites   Download all TFBS in the SGCZ promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ZNF75A_C2H2_DBD_monomeric_12_1 SELEX + 15095920 15095931 3.0E-06 TCTCTTCCCACA 12 Pax4_MA0068.1 JASPAR - 15095837 15095866 3.0E-06 GAAAATTTTTCTCTCCCTCTCTCTTTCTCT 30 ZNF282_C2H2_DBD_monomeric_17_1 SELEX - 15095789 15095805 9.0E-06 TATTCCCTCAACTCTTT 17 Meis2_MEIS_DBD_dimeric_12_1 SELEX - 15095952 15095963 8.0E-06 TGACAGATGAGA 12 V_NFAT_Q4_01_M00935 TRANSFAC - 15095860 15095869 3.0E-06 GAGGAAAATT 10 V_RELBP52_01_M01239 TRANSFAC + 15095943 15095952 8.0E-06 GGGGATTTCT 10 V_NFAT3_Q3_M01734 TRANSFAC + 15095859 15095868 1.0E-06 AAATTTTCCT 10 V_TGIF2_01_M01407 TRANSFAC + 15095952 15095967 4.0E-06 TCTCATCTGTCAAAAA 16 V_MEIS2_01_M01488 TRANSFAC + 15095952 15095967 1.0E-05 TCTCATCTGTCAAAAA 16 V_TGIF_02_M01346 TRANSFAC - 15095952 15095968 7.0E-06 CTTTTTGACAGATGAGA 17 V_NFAT_Q6_M00302 TRANSFAC - 15095860 15095871 1.0E-05 AGGAGGAAAATT 12 V_HNF1_Q6_01_M01011 TRANSFAC + 15095956 15095976 8.0E-06 ATCTGTCAAAAAGCAACATTT 21 V_TGIF1_01_M03111 TRANSFAC - 15095952 15095968 7.0E-06 CTTTTTGACAGATGAGA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.