Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ENPP6 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 133121 chr4 + 185134114 - 185144114 0 Transcription Factor Binding Sites   Download all TFBS in the ENPP6 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints FOXF2_MA0030.1 JASPAR - 185137427 185137440 7.0E-06 CTAAGATAAACAGA 14 Myf_MA0055.1 JASPAR + 185137268 185137279 1.0E-05 AGACAGCTGGAG 12 RREB1_MA0073.1 JASPAR - 185137276 185137295 7.0E-06 ACACAGCCCACCCCCACTCC 20 V_FOXP1_01_M00987 TRANSFAC + 185137419 185137438 9.0E-06 TTGTTAATTCTGTTTATCTT 20 V_FOXJ1_03_M02750 TRANSFAC - 185137423 185137438 5.0E-06 AAGATAAACAGAATTA 16 V_FOXA2_02_M02853 TRANSFAC - 185137415 185137429 5.0E-06 AGAATTAACAAAATT 15 V_MYF_01_M01302 TRANSFAC + 185137268 185137279 1.0E-05 AGACAGCTGGAG 12 V_KROX_Q6_M00982 TRANSFAC - 185137276 185137289 1.0E-05 CCCACCCCCACTCC 14 V_CDC5_01_M00478 TRANSFAC - 185137417 185137428 3.0E-06 GAATTAACAAAA 12 V_NEUROD_02_M01288 TRANSFAC - 185137268 185137279 4.0E-06 CTCCAGCTGTCT 12 V_FREAC2_01_M00290 TRANSFAC - 185137425 185137440 6.0E-06 CTAAGATAAACAGAAT 16 V_MYOD_Q6_02_M02100 TRANSFAC - 185137268 185137276 8.0E-06 CAGCTGTCT 9 V_FOXJ2_01_M00422 TRANSFAC - 185137424 185137441 4.0E-06 TCTAAGATAAACAGAATT 18 V_FREAC4_01_M00292 TRANSFAC - 185137425 185137440 2.0E-06 CTAAGATAAACAGAAT 16 V_SOX5_04_M02910 TRANSFAC - 185137419 185137433 4.0E-06 AAACAGAATTAACAA 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.