Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ZNF648 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 127665 zinc finger protein 648 chr1 - 182030347 - 182035847 182030847 Transcription Factor Binding Sites   Download all TFBS in the ZNF648 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints FOXD2_forkhead_DBD_dimeric_14_1 SELEX + 182033815 182033828 5.0E-06 AAAAAATGTTGAGA 14 FOXD3_forkhead_DBD_dimeric_14_1 SELEX + 182033815 182033828 7.0E-06 AAAAAATGTTGAGA 14 NFIX_NFI_full_monomeric_9_2 SELEX - 182033832 182033840 8.0E-06 AATGCCAAT 9 Msx3_homeodomain_DBD_dimeric_18_1 SELEX - 182034011 182034028 8.0E-06 ACAATCAGTGAAGAATTA 18 MSX1_homeodomain_DBD_dimeric_18_1 SELEX - 182034011 182034028 9.0E-06 ACAATCAGTGAAGAATTA 18 BHLHA15_bHLH_DBD_dimeric_10_1 SELEX + 182033961 182033970 6.0E-06 TCCATATGGT 10 BHLHA15_bHLH_DBD_dimeric_10_1 SELEX - 182033961 182033970 3.0E-06 ACCATATGGA 10 V_GM497_04_M02864 TRANSFAC - 182034063 182034078 4.0E-06 ACACACACACACTCAT 16 V_MEF2_04_M00233 TRANSFAC + 182033936 182033957 7.0E-06 ATGGTTGCTCAAAATATCCCAA 22 V_NKX3A_02_M01383 TRANSFAC + 182034000 182034016 2.0E-06 AAGAAAGTACCTAATTC 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.