Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR2M3 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 127062 olfactory receptor, family 2, subfamily M, member 3 chr1 + 248361369 - 248366869 248366369 Transcription Factor Binding Sites   Download all TFBS in the OR2M3 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NFIA_NFI_full_monomeric_10_1 SELEX + 248364620 248364629 5.0E-06 TTTGCCAAAT 10 TBX1_TBX_DBD_dimeric_20_1 SELEX + 248364626 248364645 9.0E-06 AAATGCCATTATAAGTGTGA 20 V_SATB1_Q3_M01723 TRANSFAC - 248364626 248364641 8.0E-06 ACTTATAATGGCATTT 16 V_ETS_Q4_M00771 TRANSFAC + 248364602 248364613 1.0E-05 TCTCACTTCCTC 12 V_SPI1_03_M02078 TRANSFAC - 248364605 248364614 4.0E-06 TGAGGAAGTG 10 V_SPIC_02_M02077 TRANSFAC - 248364605 248364614 5.0E-06 TGAGGAAGTG 10 V_SPIB_03_M02076 TRANSFAC - 248364605 248364614 5.0E-06 TGAGGAAGTG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.