Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR1I1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 126370 chr19 + 15192876 - 15202876 0 Transcription Factor Binding Sites   Download all TFBS in the OR1I1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 15202850 15202868 0.0E+00 TGGCCACTAGGTGGCAATA 19 LHX2_homeodomain_DBD_dimeric_15_1 SELEX + 15202872 15202886 9.0E-06 TCATTTCACAAATTG 5 CTCF_C2H2_full_monomeric_17_1 SELEX - 15202851 15202867 1.0E-06 ATTGCCACCTAGTGGCC 17 Hic1_C2H2_DBD_dimeric_18_1 SELEX - 15202849 15202866 6.0E-06 TTGCCACCTAGTGGCCAC 18 V_CTCF_02_M01259 TRANSFAC + 15202847 15202866 0.0E+00 AAGTGGCCACTAGGTGGCAA 20 V_CTCF_01_M01200 TRANSFAC + 15202849 15202868 0.0E+00 GTGGCCACTAGGTGGCAATA 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.