Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

NLRP8 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 126205 NLR family, pyrin domain containing 8 chr19 + 56454197 - 56459697 56459197 Transcription Factor Binding Sites   Download all TFBS in the NLRP8 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR - 56457358 56457376 4.0E-06 CGTCCAGTGGGTGGCGCTG 19 CTCF_C2H2_full_monomeric_17_1 SELEX + 56457359 56457375 9.0E-06 AGCGCCACCCACTGGAC 17 TBX20_TBX_full_dimeric_16_1 SELEX + 56457330 56457345 1.0E-06 ATGTGTGACTGTGTTA 16 V_SOX7_04_M02911 TRANSFAC + 56457323 56457344 1.0E-05 GTAGAAAATGTGTGACTGTGTT 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.