Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR7G1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 125962 olfactory receptor, family 7, subfamily G, member 1 chr19 - 9225939 - 9231439 9226439 Transcription Factor Binding Sites   Download all TFBS in the OR7G1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints LEF1_HMG_DBD_monomeric_15_1 SELEX + 9226241 9226255 4.0E-06 AGAGATTAAAGAGAA 15 Tcf7_HMG_DBD_monomeric_12_1 SELEX + 9226241 9226252 9.0E-06 AGAGATTAAAGA 12 TBX1_TBX_DBD_dimeric_20_1 SELEX + 9226226 9226245 6.0E-06 AGATGTCAGTAAAGGAGAGA 20 V_PU1_Q4_M01172 TRANSFAC - 9226250 9226268 7.0E-06 CCCATGTACTTCCTTCTCT 19 V_CRX_Q4_M00623 TRANSFAC - 9226240 9226252 7.0E-06 TCTTTAATCTCTC 13 V_GATA4_Q3_M00632 TRANSFAC + 9226243 9226254 2.0E-06 AGATTAAAGAGA 12 V_OTX2_Q3_M01719 TRANSFAC + 9226239 9226251 1.0E-05 GGAGAGATTAAAG 13 V_TAL1_01_M01591 TRANSFAC - 9226248 9226260 0.0E+00 CTTCCTTCTCTTT 13

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.