Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

C17orf64 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 124773 chromosome 17 open reading frame 64 chr17 + 58494864 - 58500364 58499864 Transcription Factor Binding Sites   Download all TFBS in the C17orf64 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Spz1_MA0111.1 JASPAR + 58499305 58499315 4.0E-06 AGGGTTACAGA 11 CTCF_C2H2_full_monomeric_17_1 SELEX - 58499002 58499018 2.0E-06 AGCGCCCCCTCGCGTCC 17 V_STAT4_Q4_M01666 TRANSFAC + 58498918 58498931 5.0E-06 TTCAGGGAAGAAAA 14 V_OLF1_01_M00261 TRANSFAC + 58499127 58499148 1.0E-05 CTCGGGTCCCTGGAGGGCTCGC 22 V_HNF1_Q6_01_M01011 TRANSFAC - 58498666 58498686 7.0E-06 TCCAGAAACTTTTTAACTTGT 21 V_MUSCLE_INI_B_M00321 TRANSFAC - 58498769 58498789 3.0E-06 CTCCCCTGCCACCCAGCGGCC 21 V_SMAD4_04_M02898 TRANSFAC - 58499162 58499178 7.0E-06 AAAGTCCCGCCACCCCG 17 V_STAT1_05_M01260 TRANSFAC + 58498915 58498936 9.0E-06 AGTTTCAGGGAAGAAAAGGTGG 22 V_HSF1_Q6_01_M02017 TRANSFAC + 58498675 58498688 9.0E-06 AAAGTTTCTGGACT 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.