Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

C16orf78 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 123970 chromosome 16 open reading frame 78 chr16 + 49402807 - 49408307 49407807 Transcription Factor Binding Sites   Download all TFBS in the C16orf78 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Klf4_MA0039.2 JASPAR + 49403711 49403720 1.0E-05 AGGGTGGGGC 10 znf143_MA0088.1 JASPAR - 49408045 49408064 9.0E-06 TCTCTCCCCTACTGCAACTA 20 DUXA_homeodomain_DBD_dimeric_13_1 SELEX - 49408265 49408277 5.0E-06 GAAATGTAATCAT 13 Sox2_MA0143.1 JASPAR - 49408268 49408282 8.0E-06 CCTTTGAAATGTAAT 15 V_TCF3_01_M01594 TRANSFAC - 49408270 49408282 1.0E-06 CCTTTGAAATGTA 13 V_YY1_02_M00069 TRANSFAC + 49403800 49403819 6.0E-06 TGGCAGCCATGTTGGTTTAA 20 V_FOXO1_02_M00474 TRANSFAC + 49408262 49408275 8.0E-06 TTGATGATTACATT 14 V_REX1_03_M01744 TRANSFAC - 49403801 49403812 0.0E+00 AACATGGCTGCC 12 V_PAX8_01_M00717 TRANSFAC + 49403596 49403610 7.0E-06 CATTTATGCTTGAGA 15 V_NKX3A_01_M00451 TRANSFAC + 49403814 49403825 7.0E-06 GTTTAAGTAAAA 12 V_PAX8_B_M00328 TRANSFAC + 49403595 49403612 2.0E-06 ACATTTATGCTTGAGAAC 18 V_GCNF_01_M00526 TRANSFAC - 49408060 49408077 7.0E-06 GTTAAGTTCAATCTCTCT 18 V_TCF4_Q5_M00671 TRANSFAC - 49408275 49408282 1.0E-05 CCTTTGAA 8 V_SOX2_01_M02246 TRANSFAC - 49408268 49408282 8.0E-06 CCTTTGAAATGTAAT 15 V_EKLF_Q5_M01874 TRANSFAC - 49403710 49403719 9.0E-06 CCCCACCCTG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.