Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ASCL4 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 121549 achaete-scute complex homolog 4 (Drosophila) chr12 + 108163161 - 108168661 108168161 Transcription Factor Binding Sites   Download all TFBS in the ASCL4 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_FOXP1_01_M00987 TRANSFAC + 108167471 108167490 1.0E-06 TTATTTGCCTTGTTTTTTGA 20 V_HNF3_Q6_01_M01012 TRANSFAC + 108167467 108167484 0.0E+00 TATTTTATTTGCCTTGTT 18 V_E2A_Q2_M00804 TRANSFAC + 108169286 108169299 6.0E-06 CCACCTGCCCCGGG 14 V_TCFAP2E_04_M02926 TRANSFAC - 108167480 108167493 9.0E-06 AACTCAAAAAACAA 14 V_HNF3G_Q4_M02015 TRANSFAC - 108167514 108167521 7.0E-06 TGTTTGTT 8 V_HNF3ALPHA_Q6_M00724 TRANSFAC - 108167511 108167521 2.0E-06 TGTTTGTTCTA 11 V_OCT1_04_M00138 TRANSFAC - 108167466 108167488 5.0E-06 AAAAAACAAGGCAAATAAAATAG 23 V_FOXO1_Q5_M01216 TRANSFAC - 108167479 108167487 8.0E-06 AAAAACAAG 9 V_E47_01_M00002 TRANSFAC - 108169282 108169296 6.0E-06 GGGGCAGGTGGTCTC 15 V_FOXJ2_01_M00422 TRANSFAC - 108167467 108167484 9.0E-06 AACAAGGCAAATAAAATA 18 V_FOXO1_01_M00473 TRANSFAC - 108167479 108167488 5.0E-06 AAAAAACAAG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.