Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 120775 chr11 + 6937232 - 6947232 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_NFY_Q6_01_M00775 TRANSFAC + 6947095 6947107 4.0E-06 ACTCAACCAATGG 13 V_IRX4_01_M01410 TRANSFAC - 6946952 6946968 3.0E-06 TAAGTACATGATAATAT 17 V_OCT1_04_M00138 TRANSFAC - 6946947 6946969 7.0E-06 TTAAGTACATGATAATATGATTA 23 V_NKX3A_01_M00451 TRANSFAC - 6946960 6946971 4.0E-06 CATTAAGTACAT 12 V_NKX23_01_M01457 TRANSFAC + 6946956 6946971 6.0E-06 TATCATGTACTTAATG 16 V_NKX23_01_M01457 TRANSFAC - 6946956 6946971 6.0E-06 CATTAAGTACATGATA 16 V_IRX5_01_M01472 TRANSFAC - 6946952 6946968 6.0E-06 TAAGTACATGATAATAT 17 V_TFIII_Q6_M00706 TRANSFAC - 6947043 6947051 1.0E-05 AGAGGTAGG 9 V_ELF1_Q6_M00746 TRANSFAC - 6947036 6947047 3.0E-06 GTAGGAGGAAAT 12 V_IRX3_02_M01485 TRANSFAC - 6946952 6946968 8.0E-06 TAAGTACATGATAATAT 17 V_STAT6_02_M00500 TRANSFAC + 6947035 6947042 1.0E-05 GATTTCCT 8 V_IRX2_01_M01405 TRANSFAC - 6946952 6946968 5.0E-06 TAAGTACATGATAATAT 17 V_IRXB3_01_M01377 TRANSFAC - 6946952 6946968 1.0E-06 TAAGTACATGATAATAT 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.