Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR51A7 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 119687 olfactory receptor, family 51, subfamily A, member 7 chr11 + 4923599 - 4929099 4928599 Transcription Factor Binding Sites   Download all TFBS in the OR51A7 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints FOXA1_MA0148.1 JASPAR - 4925467 4925477 3.0E-06 TGTTTGCTCTT 11 Irx3_homeodomain_DBD_dimeric_12_1 SELEX - 4926541 4926552 5.0E-06 CTACATGGAAAA 12 V_STAT4_Q4_M01666 TRANSFAC + 4925460 4925473 1.0E-06 TTCACAGAAGAGCA 14 V_GFI1_01_M00250 TRANSFAC - 4925516 4925539 5.0E-06 TTGGTTTAAATCTCAGCATGGCAA 24 V_HNF3ALPHA_Q6_M00724 TRANSFAC - 4925467 4925477 4.0E-06 TGTTTGCTCTT 11 V_LRH1_Q5_M01142 TRANSFAC - 4926530 4926541 4.0E-06 AGGGCCTTGAAC 12 V_POU5F1_01_M01307 TRANSFAC - 4926476 4926485 9.0E-06 AATGCAAAAC 10 V_STAT1STAT1_Q3_M01212 TRANSFAC + 4925458 4925470 1.0E-06 ATTTCACAGAAGA 13 V_HNF3B_Q6_M02014 TRANSFAC - 4925470 4925478 6.0E-06 TTGTTTGCT 9 V_CP2_01_M00072 TRANSFAC - 4926472 4926482 6.0E-06 GCAAAACCCAG 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.