Search TFs
or Genes		 Construction
and Validation		 Optimal
Promoter Size		 Download Citation and
Contact


EntrezDescriptionChrom.StrandPromoter
(Start - Stop)		TSS
116179 chr15 +43589453 - 43599453 0

Transcription Factor Binding Sites

 
Download all TFBS in the promoter
 
MotifSourceStrandStartStop PValueMatch
Sequence		Overlap w/
Footprints
V_GR_01_M00955 TRANSFAC + 43590244 43590270 1.0E-05 GTCTGAAAGAATTTATGTTCTCACCAA 27
V_IRX5_01_M01472 TRANSFAC + 43590235 43590251 5.0E-06 ATTTTACATGTCTGAAA 17
V_FOXL1_02_M02857 TRANSFAC + 43592315 43592330 4.0E-06 TTCTTCAAACAAAACC 16
Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns.
Developed at the Institute for Systems Biology in the Baliga Lab.
A Django site.   Powered by PostgreSQL