Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PNMA5 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 114824 paraneoplastic Ma antigen family member 5 chrX - 152160261 - 152167671 152160761 Transcription Factor Binding Sites   Download all TFBS in the PNMA5 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Pax4_MA0068.1 JASPAR + 152158022 152158051 5.0E-06 AAAAACAACTACCCACCCCCAACACATCCT 30 FOXJ3_forkhead_DBD_dimeric_14_1 SELEX + 152158015 152158028 8.0E-06 GCAAACCAAAAACA 14 V_MYCMAX_02_M00123 TRANSFAC - 152160850 152160861 3.0E-06 TACCACATGACA 12 V_FOXO1_Q5_M01216 TRANSFAC + 152158022 152158030 5.0E-06 AAAAACAAC 9 V_CAAT_C_M00200 TRANSFAC + 152158039 152158063 3.0E-06 CCCAACACATCCTCTCTTCTCTTCT 25 V_FOXO4_01_M00472 TRANSFAC + 152158022 152158032 8.0E-06 AAAAACAACTA 11 V_PAX4_04_M00380 TRANSFAC + 152158022 152158051 1.0E-06 AAAAACAACTACCCACCCCCAACACATCCT 30

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.