Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SLC22A9 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 114571 solute carrier family 22 (organic anion transporter), member 9 chr11 + 63132260 - 63137760 63137260 Transcription Factor Binding Sites   Download all TFBS in the SLC22A9 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints SOX10_HMG_full_dimeric_16_1 SELEX + 63137201 63137216 7.0E-06 ACCAAAGTCCAGTGCT 16 HNF4A_nuclearreceptor_full_dimeric_16_1 SELEX + 63137198 63137213 2.0E-06 TAGACCAAAGTCCAGT 16 HNF4A_MA0114.1 JASPAR + 63137199 63137211 1.0E-06 AGACCAAAGTCCA 13 V_FOXA2_04_M02749 TRANSFAC - 63137177 63137193 1.0E-06 TTTCTGTAAACAAACTA 17 V_HNF4_Q6_M00967 TRANSFAC + 63137204 63137212 1.0E-05 AAAGTCCAG 9 V_HNF4A_03_M02220 TRANSFAC + 63137199 63137211 1.0E-06 AGACCAAAGTCCA 13 V_HNF4A_Q6_01_M02016 TRANSFAC + 63137200 63137214 1.0E-06 GACCAAAGTCCAGTG 15 V_HNF4A_02_M02868 TRANSFAC + 63137200 63137215 9.0E-06 GACCAAAGTCCAGTGC 16 V_FREAC2_01_M00290 TRANSFAC - 63137178 63137193 4.0E-06 TTTCTGTAAACAAACT 16 V_FOXL1_04_M02753 TRANSFAC - 63137177 63137193 1.0E-06 TTTCTGTAAACAAACTA 17 V_HNF4_Q6_01_M01031 TRANSFAC + 63137199 63137212 2.0E-06 AGACCAAAGTCCAG 14 V_FOXJ2_01_M00422 TRANSFAC - 63137177 63137194 7.0E-06 TTTTCTGTAAACAAACTA 18 V_TAACC_B_M00331 TRANSFAC + 63137186 63137208 5.0E-06 TACAGAAAAGTGTAGACCAAAGT 23 V_FOXK1_03_M02752 TRANSFAC - 63137177 63137193 3.0E-06 TTTCTGTAAACAAACTA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.