Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

TXNRD3 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 114112 thioredoxin reductase 3 chr3 - 126373467 - 126378967 126373967 Transcription Factor Binding Sites   Download all TFBS in the TXNRD3 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints KLF16_C2H2_DBD_monomeric_11_1 SELEX + 126373981 126373991 1.0E-05 GCCCCGCCCCC 11 T_MA0009.1 JASPAR + 126374040 126374050 3.0E-06 CTAGGTGTCAC 11 SP1_MA0079.2 JASPAR + 126373982 126373991 7.0E-06 CCCCGCCCCC 10 SP4_C2H2_full_monomeric_17_1 SELEX + 126373978 126373994 8.0E-06 CTCGCCCCGCCCCCCAA 17 V_SP1_Q6_01_M00931 TRANSFAC - 126373981 126373990 4.0E-06 GGGGCGGGGC 10 V_AP2_Q6_01_M00915 TRANSFAC - 126373908 126373920 6.0E-06 CGCCCCTCAGGCC 13 V_SP1_03_M02281 TRANSFAC + 126373982 126373991 7.0E-06 CCCCGCCCCC 10 V_AMEF2_Q6_M00403 TRANSFAC - 126373199 126373216 7.0E-06 GTGTTTAAGAATACTTCA 18 V_SP1_Q6_M00196 TRANSFAC - 126373980 126373992 1.0E-06 GGGGGGCGGGGCG 13 V_CTCF_01_M01200 TRANSFAC + 126373649 126373668 6.0E-06 AGGCCCACGAGGTGGCGGCG 20 V_SP4_Q5_M01273 TRANSFAC + 126373981 126373991 1.0E-06 GCCCCGCCCCC 11 V_NRF1_Q6_M00652 TRANSFAC - 126374003 126374012 4.0E-06 CGCATGCGCG 10 V_SP1_Q2_01_M00933 TRANSFAC + 126373982 126373991 4.0E-06 CCCCGCCCCC 10 V_SP1_Q4_01_M00932 TRANSFAC - 126373980 126373992 2.0E-06 GGGGGGCGGGGCG 13 V_RNF96_01_M01199 TRANSFAC + 126374031 126374040 7.0E-06 GCCCGCAGCC 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.