Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 11283 chr19 + 15721028 - 15731028 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Tcfap2a_TFAP_DBD_dimeric_13_1 SELEX + 15727808 15727820 8.0E-06 TCCCCTGGGGGCT 13 TFAP2A_TFAP_DBD_dimeric_13_1 SELEX - 15727808 15727820 8.0E-06 AGCCCCCAGGGGA 13 Hltf_MA0109.1 JASPAR - 15727896 15727905 1.0E-05 ATCCTTTTAT 10 ELF5_MA0136.1 JASPAR - 15727828 15727836 9.0E-06 AACTTCCTT 9 V_RUSH1A_02_M01107 TRANSFAC - 15727896 15727905 1.0E-05 ATCCTTTTAT 10 V_AP2_Q6_01_M00915 TRANSFAC - 15727866 15727878 9.0E-06 GGGGCCCCAGGCC 13 V_OLF1_01_M00261 TRANSFAC + 15727802 15727823 4.0E-06 CTCTTCTCCCCTGGGGGCTGCT 22 V_SRF_Q4_M00810 TRANSFAC + 15727893 15727910 8.0E-06 GACATAAAAGGATGTGGG 18 V_ELF5_04_M02241 TRANSFAC - 15727828 15727836 9.0E-06 AACTTCCTT 9 V_ZIC2_04_M02836 TRANSFAC + 15727806 15727820 7.0E-06 TCTCCCCTGGGGGCT 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.