Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

MRAP2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 112609 melanocortin 2 receptor accessory protein 2 chr6 + 84738419 - 84743919 84743419 Transcription Factor Binding Sites   Download all TFBS in the MRAP2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints TBX1_TBX_DBD_dimeric_23_1 SELEX + 84743536 84743558 4.0E-06 TCGCGCACCTCGGAGGAGCCAGG 23 TBX1_TBX_DBD_dimeric_23_1 SELEX - 84743536 84743558 2.0E-06 CCTGGCTCCTCCGAGGTGCGCGA 23 V_HNF4ALPHA_Q6_M00638 TRANSFAC - 84743329 84743341 1.0E-05 GTGAGCTTTGCAG 13 V_MAZ_Q6_01_M02023 TRANSFAC - 84743903 84743916 2.0E-06 AGCGGAGGGGAGGA 14 V_AP2BETA_Q3_M01858 TRANSFAC - 84743577 84743592 6.0E-06 GCCCCGGCCCGCGGGC 16 V_OCAB_Q6_M02113 TRANSFAC + 84743327 84743337 7.0E-06 ATCTGCAAAGC 11 V_AP2_Q3_M00800 TRANSFAC + 84743499 84743514 8.0E-06 GGCCCTGGGCGGTGGG 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.