Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

LILRA3 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 11026 leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 chr19 - 54803721 - 54809265 54804221 Transcription Factor Binding Sites   Download all TFBS in the LILRA3 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints FIGLA_bHLH_DBD_dimeric_10_1 SELEX - 54808926 54808935 7.0E-06 ACCACCTGGT 10 MTF1_C2H2_DBD_monomeric_14_1 SELEX + 54808571 54808584 9.0E-06 TATGCAGACGCCAC 14 V_MATH1_Q2_M01716 TRANSFAC - 54808925 54808934 9.0E-06 CCACCTGGTG 10 V_MUSCLE_INI_B_M00321 TRANSFAC + 54808573 54808593 9.0E-06 TGCAGACGCCACCCAGAGGTT 21 V_OCAB_Q6_M02113 TRANSFAC - 54808548 54808558 7.0E-06 ATCTGCAAACC 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.