Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 10917 chr5 + 180410844 - 180420844 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_GATA3_05_M02859 TRANSFAC - 180417405 180417426 9.0E-06 TGTCACAGATGTGATCTTATTA 22 V_EVI1_01_M00078 TRANSFAC + 180417400 180417415 9.0E-06 AGAGATAATAAGATCA 16 V_GATA3_02_M00350 TRANSFAC + 180417400 180417409 0.0E+00 AGAGATAATA 10 V_TBX22_01_M01195 TRANSFAC - 180417402 180417420 6.0E-06 AGATGTGATCTTATTATCT 19 V_GATA2_03_M00349 TRANSFAC + 180417400 180417409 1.0E-06 AGAGATAATA 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.