Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CEACAM8 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 1088 carcinoembryonic antigen-related cell adhesion molecule 8 chr19 - 43098582 - 43104082 43099082 Transcription Factor Binding Sites   Download all TFBS in the CEACAM8 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR - 43100809 43100827 1.0E-06 AGTCCACCAGAGGGCGACA 19 CTCF_C2H2_full_monomeric_17_1 SELEX + 43100810 43100826 5.0E-06 GTCGCCCTCTGGTGGAC 17 V_CTCF_02_M01259 TRANSFAC - 43100811 43100830 5.0E-06 TCCAGTCCACCAGAGGGCGA 20 V_CTCF_01_M01200 TRANSFAC - 43100809 43100828 9.0E-06 CAGTCCACCAGAGGGCGACA 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.