Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SLCO1B1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 10599 solute carrier organic anion transporter family, member 1B1 chr12 + 21279127 - 21284627 21284127 Transcription Factor Binding Sites   Download all TFBS in the SLCO1B1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ZNF435_C2H2_full_dimeric_18_1 SELEX - 21282930 21282947 5.0E-06 CCTGTTAAATAAGCACTT 18 V_TGIF_01_M00418 TRANSFAC - 21283002 21283012 3.0E-06 AGTTGTCAAAA 11 V_TBX15_01_M01263 TRANSFAC - 21282994 21283012 5.0E-06 AGTTGTCAAAATAGCAATC 19 V_MAFK_03_M02776 TRANSFAC + 21282927 21282941 6.0E-06 TCAAAGTGCTTATTT 15 V_NKX29_01_M01352 TRANSFAC + 21282926 21282942 3.0E-06 TTCAAAGTGCTTATTTA 17 V_MAFB_03_M02879 TRANSFAC - 21282919 21282933 8.0E-06 ACTTTGAAAAATTTT 15 V_MEF2_04_M00233 TRANSFAC - 21282994 21283015 4.0E-06 GCGAGTTGTCAAAATAGCAATC 22 V_MAFK_Q3_M02022 TRANSFAC + 21283026 21283036 7.0E-06 TTACTCAGCAG 11 V_NKX23_01_M01457 TRANSFAC + 21282926 21282941 5.0E-06 TTCAAAGTGCTTATTT 16 V_NKX32_02_M01482 TRANSFAC - 21282924 21282940 7.0E-06 AATAAGCACTTTGAAAA 17 V_FOXJ3_06_M02855 TRANSFAC - 21283055 21283071 1.0E-05 AAGGCCAAAATATTAGA 17 V_NKX3A_02_M01383 TRANSFAC - 21282925 21282941 3.0E-06 AAATAAGCACTTTGAAA 17 V_NKX3A_02_M01383 TRANSFAC + 21282926 21282942 3.0E-06 TTCAAAGTGCTTATTTA 17 V_VMAF_01_M00035 TRANSFAC + 21283020 21283038 9.0E-06 AGATTCTTACTCAGCAGAG 19 V_TAACC_B_M00331 TRANSFAC - 21283068 21283090 9.0E-06 AACTGAGAAATGTAGACCCAAGG 23

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.