Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PRSS46 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 100287362 protease, serine, 46 chr3 - 46777421 - 46782921 46777921 Transcription Factor Binding Sites   Download all TFBS in the PRSS46 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Sox1_HMG_DBD_dimeric_13_1 SELEX + 46779154 46779166 8.0E-06 TCACTAGCAGTGC 13 SOX14_HMG_DBD_dimeric_13_1 SELEX + 46779154 46779166 1.0E-05 TCACTAGCAGTGC 13 V_MYOGNF1_01_M00056 TRANSFAC + 46779158 46779186 9.0E-06 TAGCAGTGCTGCTGGGAAGGGTCCCAGCT 29 V_SMAD3_Q6_M00701 TRANSFAC - 46775200 46775208 1.0E-05 TGTCTGCCT 9

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.