Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

INSL5 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 10022 insulin-like 5 chr1 - 67266442 - 67271942 67266942 Transcription Factor Binding Sites   Download all TFBS in the INSL5 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints IRF2_MA0051.1 JASPAR - 67267206 67267223 4.0E-06 TGAGAGTGAAACTCATTC 18 V_NF1_Q6_01_M00806 TRANSFAC + 67267191 67267207 1.0E-06 TTTGAAAGTTGCCAAGA 17 V_NF1A_Q6_M02103 TRANSFAC + 67267191 67267206 7.0E-06 TTTGAAAGTTGCCAAG 16 V_HELIOSA_02_M01004 TRANSFAC + 67267172 67267182 4.0E-06 TTATGGAAAAC 11 V_STAF_01_M00262 TRANSFAC - 67267161 67267182 5.0E-06 GTTTTCCATAATGCCTTCCAAG 22 V_STAF_02_M00264 TRANSFAC - 67267162 67267182 0.0E+00 GTTTTCCATAATGCCTTCCAA 21 V_BLIMP1_Q6_M01066 TRANSFAC - 67267209 67267224 5.0E-06 CTGAGAGTGAAACTCA 16 V_RFX3_04_M02788 TRANSFAC - 67267191 67267213 9.0E-06 ACTCATTCTTGGCAACTTTCAAA 23 V_NF1_Q6_M00193 TRANSFAC - 67267190 67267207 4.0E-06 TCTTGGCAACTTTCAAAG 18

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.