Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ZNF705B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 100132396 zinc finger protein 705B chr8 + 7778858 - 7784358 7783858 Transcription Factor Binding Sites   Download all TFBS in the ZNF705B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_TCF11MAFG_01_M00284 TRANSFAC + 7779478 7779499 1.0E-05 GAGATGTGAGTGAATAATTATG 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.