Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CTAGE4 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 100128553 CTAGE family, member 4 chr7 - 143875547 - 143881047 143876047 Transcription Factor Binding Sites   Download all TFBS in the CTAGE4 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 143875671 143875689 1.0E-06 AAGCCAGTAGATGGCGCTT 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 143875672 143875688 0.0E+00 AGCGCCATCTACTGGCT 17 V_HOXB13_01_M01467 TRANSFAC - 143875639 143875654 3.0E-06 AGCCCAATATAAAACC 16 V_CTCF_02_M01259 TRANSFAC + 143875668 143875687 0.0E+00 TACAAGCCAGTAGATGGCGC 20 V_CTCF_01_M01200 TRANSFAC + 143875670 143875689 3.0E-06 CAAGCCAGTAGATGGCGCTT 20 V_TCF3_05_M02920 TRANSFAC - 143875640 143875654 2.0E-06 AGCCCAATATAAAAC 15 V_PAX4_04_M00380 TRANSFAC - 143875711 143875740 6.0E-06 AAGAATCAAGTATATACCCAGCCCCACTGG 30 V_ER_Q6_M00191 TRANSFAC + 143875652 143875670 9.0E-06 GCTGGGTACTTTGACCTAC 19

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.